lmrA [2018-02-13T12:20:10.000Z]

transcriptional regulator (TetR family), control of qdoI-yxaH and lmrA-lmrB

Locus: BSU02680

Isoelectric point: 5.03

Molecular weight: 20.52 kDa

Protein length: 188 aa

Gene length: 564 bp

Function: regulation of lincomycin resistance

Product: transcriptional regulator

Essential: no

Synonyms: lin-2,yccB

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → Resistance against toxins/ antibiotics

Gene

Coordinates: 290,132 → 290,698

The protein

Protein family

• TetR family

Paralogous protein(s)

• QdoR

Effectors of protein activity

• flavonoids such as quercetin serve as inducers, binding results in release from DNA PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: lmrA-lmrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • LmrA: repression, PubMed, in LmrA regulon

  Regulation

  • induced by flavonoids such as quercetin (LmrA)PubMed

  Additional information

  • the mRNA is substantially stabilized upon depletion of RNase Y PubMed

Biological materials

Mutant

• BKE02680 (ΔlmrA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACATTCCCACCTTACT, downstream forward: _UP4_TAAAAAAAACGACATACTAC
• BKK02680 (ΔlmrA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAACATTCCCACCTTACT, downstream forward: _UP4_TAAAAAAAACGACATACTAC

References

Reviews

Loading

Original publications

Loading